The Journal of Neuroscience, September 2, 2009 " 29(35):11029 11037 " 11029
Behavioral/Systems/Cognitive
The Effects of Caffeine on Sleep in Drosophila Require PKA
Activity, But Not the Adenosine Receptor
Mark N. Wu,1* Karen Ho,2* Amanda Crocker,2 Zhifeng Yue,3 Kyunghee Koh,2 and Amita Sehgal2,3
1 2 3
Division of Sleep Medicine, Department of Neurology, Department of Neuroscience, and Howard Hughes Medical Institute, University of Pennsylvania,
Philadelphia, Pennsylvania 19104
Caffeine is one of the most widely consumed stimulants in the world and has been proposed to promote wakefulness by antagonizing
function of the adenosine A2A receptor. Here, we show that chronic administration of caffeine reduces and fragments sleep in Drosophila
and also lengthens circadian period. To identify the mechanisms underlying these effects of caffeine, we first generated mutants of the
only known adenosine receptor in flies (dAdoR), which by sequence is most similar to the mammalian A2A receptor. Mutants lacking
dAdoR have normal amounts of baseline sleep, as well as normal homeostatic responses to sleep deprivation. Surprisingly, these mutants
respond normally to caffeine. On the other hand, the effects of caffeine on sleep and circadian rhythms are mimicked by a potent
phosphodiesterase inhibitor, IBMX (3-isobutyl-1-methylxanthine). Using in vivo fluorescence resonance energy transfer imaging, we
find that caffeine induces widespread increase in cAMP levels throughout the brain. Finally, the effects of caffeine on sleep are blocked in
flies that have reduced neuronal PKA activity. We suggest that chronic administration of caffeine promotes wakefulness in Drosophila, at
least in part, by inhibiting cAMP phosphodiesterase activity.
et al., 1997; Methippara et al., 2005), whereas knockdown of the
Introduction
A1 receptor using antisense oligonucleotides reduces baseline
Caffeine is one of the most commonly used psychoactive sub-
sleep and impairs homeostatic regulation of sleep (Thakkar et
stances and has been shown to antagonize adenosine receptor
al., 2003).
signaling, inhibit cAMP phosphodiesterase (PDE) activity, and
Despite these findings, there is little genetic evidence indicat-
activate ryanodine receptors. However, the promotion of wake-
fulness by caffeine is widely thought to be mediated by its antag- ing an essential role for adenosine receptors in the regulation of
sleep. Mouse knock outs of the A1 or A2A receptor have no alter-
onism of adenosine receptors, based on its higher affinity for
ations of baseline sleep amount (Stenberg et al., 2003; Huang et
these molecules (Fredholm et al., 1999).
In addition to its connection to caffeine, adenosine itself is al., 2005). In addition, A1 knock-out mice have no defects in the
strongly implicated in sleep regulation, as a sleep-promoting fac- homeostatic regulation of sleep (Stenberg et al., 2003), and nor
tor (Radulovacki et al., 1984; Rainnie et al., 1994; Basheer et al., are there any published data demonstrating such defects for A2A
2004). Microdialysis experiments demonstrate that increased knock-out mice. However, A2A knock-out mice do appear to be
sleep drive is accompanied by an increase in endogenous adeno- insensitive to the wake-promoting effects of acute caffeine injec-
sine levels locally in the basal forebrain and in the cortex (Porkka- tion (Huang et al., 2005). Recently, mice with targeted deletion of
Heiskanen et al., 1997). There are four adenosine receptors in
the A1 receptor in CAMKII cells were described. These mice do
mammals: A1, A2A, A2B, and A3. A1 and A2A receptors are en-
not show significant changes in amount of total or slow wave
riched in the nervous system, while the others are expressed dif-
sleep, but do exhibit decreased slow-wave activity (SWA) power
fusely at low levels (Landolt, 2008). Administration of A1 and A2A at baseline and following sleep deprivation (Bjorness et al., 2009).
receptor agonists promotes sleep (Benington et al., 1995; Portas
Finally, recent data suggest that eliminating adenosine accumu-
lation in the basal forebrain of rats has no effect on sleep rebound
or delta power following sleep deprivation (Blanco-Centurion et
Received April 6, 2009; revised July 22, 2009; accepted July 23, 2009.
al., 2006). Together, these findings suggest that despite the strong
M.N.W. is supported by a Career Award for Medical Scientists Award from the Burroughs-Wellcome Foundation
evidence implicating adenosine in sleep regulation, further ex-
and National Institute of Neurological Disorders and Stroke Grant K08NS059671. K.H. was supported by a Pickwick
Fellowship from the National Sleep Foundation. K.K. is supported by National Institutes of Health (NIH) Grant periments, particularly in vivo genetic analyses, may be helpful in
P01AG017628. A.S. is supported by NIH Grants R01NS048471 and P01AG017628 and is an Investigator of the
evaluating this hypothesis.
HowardHughesMedicalInstitute.WethankH.Keshishian,R.Davis,J.Kiger,andP.Taghertforflylines.WethankW.
Here, we demonstrate that chronic administration of caffeine
Joiner for comments and for outcrossing lines and the Sehgal laboratory for helpful discussions. We thank H. Su for
reduces and fragments sleep in Drosophila and also lengthens
providing the original dAdoR cDNA clone.
*M.N.W. and K.H. contributed equally to this work. circadian period. Similar effects on sleep and circadian period are
Correspondence should be addressed to Amita Sehgal, Department of Neuroscience/University of Pennsylvania,
observed when flies are fed isobutylmethylxanthine (IBMX), a
232 Stemmler Hall, 3450 Hamilton Walk, Philadelphia, PA 19104. E-mail: amita@mail.med.upenn.edu.
nonspecific phosphodiesterase inhibitor. Surprisingly, these ef-
M. N. Wu s present address: Department of Neurology, Johns Hopkins University, Baltimore, MD 21287.
fects of caffeine on sleep and circadian rhythms are not mediated
DOI:10.1523/JNEUROSCI.1653-09.2009
Copyright © 2009 Society for Neuroscience 0270-6474/09/2911029-09$15.00/0 by the single adenosine receptor identified in flies. Instead, we
11030 " J. Neurosci., September 2, 2009 " 29(35):11029 11037 Wu et al. " Caffeine and Sleep in Drosophila
find widespread elevations of cAMP levels in the fly brain with
AB
caffeine treatment and show that the effects of caffeine on sleep 800
30
no caff
0.5 mg/ml
caff
require PKA activity. We propose that in Drosophila the mecha-
25
***
600
nisms underlying wake-promoting effects of chronic caffeine ad-
20
***
ministration involve enhanced cAMP/PKA signaling.
400
15
10
200
5
Materials and Methods
Fly stocks. Fly stocks were raised at 23°C on standard cornmeal-molasses
0 0.1 0.2 0.5
caffeine (mg/ml)
medium. The wild-type caffeine sensitive strain RC1 (#3865), KG03964
(#13273), and Df(3R)Exel6214 (#7692), and elav-Gal4 C155 (#458) were
CD
120
30
obtained from the Bloomington Stock Center (Bloomington, IN). All
100
***
lines used for behavioral analysis in this study were outcrossed at least 5 25
80
into the RC1 background. The P-insertion line KG03964 was mobilized
20
***
***
***
to generate dAdoR, which bears a 4562 bp deletion removing the entire
60
15
***
dAdoR open reading frame (ORF). For the dAdoR mutant, sibling con-
40
10
trols were established after outcrossing 5 into the RC1 background.
***
5 20
elav-GS was provided by H. Keshishian (Yale University, New Haven,
CT), MB-GS by R. Davis (Baylor College of Medicine, Houston, TX), 0 0.1 0.2 0.5
0 0.1 0.2 0.5
caffeine (mg/ml) caffeine (mg/ml)
UAS-PKAR by J. Kiger (UC Davis, Davis, CA), and UAS-Epac1-camps by
P. Taghert (Washington University, St. Louis, MO).
Molecular biology. A partial dAdoR (CG9753) cDNA was obtained by RT- E F
**
3 100
no caff
PCR. The remaining 3 end of the dAdoR ORF was isolated using PCR from 0.5 mg/ml
*
caff
2.5
80
a BAC clone containing the region (RH38494, Invitrogen), using the follow-
*
2
ing primers: forward primer-5 CTGTTCCAAATCCCGTTC and reverse
60
1.5
primer-5 CAAGGTACCGAAGGTCAACTCTCCG and subsequently con-
40
firmed by sequencing. An in-frame fusion of GFP to the C-terminal end of 1
20
dAdoR was created by PCR of the same 3 dAdoR fragment, with the STOP
0.5
codon mutated to Gly using the primer reverse-5 CAGGTACCCGAAG-
0 0.1 0.2 0.5 mild mod
GTCCACTCTCCG. For expression of dAdoR-GFP in S2 cells, the
caffeine (mg/ml)
dAdoR-GFP cDNA was subcloned into the pAC-V5-HisA vector.
Quantitative real-time PCR was performed essentially as previously
Figure 1. Effects of caffeine on sleep and arousal on wild-type RC1 flies. A, Sleep profile
described (Zheng et al., 2007).
plotted in 30 min bins for female flies fed no caffeine (open diamonds) or 0.5 mg/ml caffeine
Cell culture assays and Western blotting. dAdoR-GFP was transfected
(closed squares). Gray bars and black bars represent subjective day and night, respectively. B,
into S2 cells using Cellfectin (Invitrogen) according to manufacturer s
Daily sleep time for female flies fed 0 (n 64), 0.1 (n 63), 0.2 (n 63), or 0.5 (n 64)
protocol. A stably expressing dAdoR-GFP cell was selected by individual
mg/ml caffeine. In this and subsequent figures, error bars represent SEM. C E, Daily sleep bout
cell-sorting based on GFP fluorescence intensity. This line was used in all
number (C), daily sleep bout duration (D), and waking activity (E) for female flies fed 0, 0.1, 0.2,
subsequent cell culture experiments, with the original S2 line passaged in
or 0.5 mg/ml caffeine. In D, sleep bout duration, which is not normally distributed, is presented
tandem used as the control. MAPK phosphorylation in response to 3 M
as simplified box plots. The line inside each box indicates the median, and the top and bottom
adenosine (Sigma) was measured using anti-MAPK and anti-P-MAPK
represent75thand25thpercentiles,respectively.Similarboxplotsareshownforallsubsequent
antibodies (Sigma). Expression of dAdoR-GFP protein in S2 cells was
plots of sleep bout duration. F, Arousal threshold measurements for female flies fed no caffeine
confirmed by Western blotting of transfected cell extracts using anti-GFP
(white bars) or 0.5 mg/ml caffeine (black bars), in response to a mild ( mild ) or a moderate
and anti-V5 antibodies (Invitrogen) and ECL (Pierce). The ratio of phos-
( mod ) mechanical stimulus. For mild stimulus, n 109 for no caffeine and n 99 for
phorylated versus total MAPK was measured by digital densitometry
caffeine-fed, and for moderate stimulus, n 112 for no caffeine and n 93 for caffeine-fed.
using a Kodak 440 CF Image Station with Kodak 1D software (Kodak).
*p 0.05, **p 0.01, ***p 0.001, compared with the no-caffeine group. Data from the
Behavioral assays. Sleep and circadian behavior were measured using
same flies are shown from A E. caff, Caffeine.
Drosophila Activity Monitoring Systems (Trikinetics) in 5% sucrose/2%
agarose glass tubes maintained in a well humidified incubator (Thermo
Scientific) at 25°C. Sleep was identified as a minimum of 5 min of loco- formed essentially as described (Wu et al., 2008), except that only mild
motor inactivity as described previously (Andretic and Shaw, 2005; Ho and moderate stimuli were used.
and Sehgal, 2005). Sleep data were collected in 1 min bins and analyzed For rebound experiments using mechanical deprivation, flies were
using a sliding window with custom-designed MATLAB software (Math- deprived of sleep from ZT18-24 as previously described, and only ani-
Works). Circadian data were analyzed using Clocklab (Actimetrics Soft- mals whose sleep was decreased by at least 70% over the 6 h period were
ware). Unless otherwise specified, flies used in behavioral experiments included in the analysis (Wu et al., 2008). Sleep latency was defined as
were pre-entrained for 2dina12/12 h light/dark (L/D) cycle. Flies were time after ZT0 following deprivation until the first bout of sleep.
5 8-d-old at the start of the behavioral experiments. For RU486 induction of elav-Geneswitch and MB-Geneswitch drivers,
For measurements of baseline sleep phenotypes, data were recorded flies were fed 0.5 mM RU486 in 1% EtOH as diluent (Sigma) for2din5%
for 2 d in a 12/12 L/D cycle and averaged. For circadian measurements, sucrose/2% agarose tubes, and then transferred into 5% sucrose/2% aga-
activity was recorded for 6 d in constant darkness (DD). For caffeine rose tubes containing either no caffeine or caffeine (0.5 mg/ml). For
treatment, flies (after pre-entrainment) were transferred to 5% su- uninduced controls, flies were fed 1% EtOH alone.
crose/2% agarose tubes containing either no caffeine or caffeine (ranging Fluorescent resonance energy transfer imaging of cAMP levels. Brains
from 0.1 to 0.5 mg/ml) (Sigma) at the subjective light-onset time (CT0) from elav-Gal4/ ; UAS-Epac1-camps (50A)/ (Shafer et al., 2008) flies
in DD. For IBMX (Sigma), flies were treated as for caffeine treatment, were dissected in ice-cold calcium-free saline containing 46 mM NaCl,
except they were fed IBMX in doses ranging from 0.025 to 0.1 mg/ml in 180 mM KCl, and 10 mM Tris, pH 7.2. The brains were then laid at the
1% EtOH), and corresponding control flies were fed 1% EtOH. For CPT bottom of a 35 10 mm plastic FALCON Petri dish (Becton Dickenson
(8-cyclopentyll-1,3-dimethylxanthine) and DMPX (3,7-dimethyl-1- Labware), given a few seconds to adhere and then covered with 1.6 ml of
propargylxanthine) (Sigma), flies were treated as for caffeine, except that hemolymph-like saline (HL3) containing 70 mM NaCl, 5 mM KCl, 1.5 mM
0.6 mg/ml and 0.3 mg/ml doses were used respectively, and drugs were CaCl2, 20mM MgCl2, 10mM NaHCO3, 5mM trehalose, 115 mM sucrose,
solubilized by adjusting pH. Arousal threshold experiments were per- and5mM HEPES, pH 7.1 (Shafer et al., 2008).
Sleep time (min)
Sleep (per 30 min bin)
Sleep bout number
Sleep bout duration (min)
% Aroused
Activity/min awake
Wu et al. " Caffeine and Sleep in Drosophila J. Neurosci., September 2, 2009 " 29(35):11029 11037 " 11031
Time course fluorescent resonance energy
AB
transfer (FRET) imaging of pan-neuronally ex-
25.4
male pressed Epac1-camps was performed on indi-
female
***
vidual brains using a Leica TCS SP5 confocal
25
**
microscope using a HCX APO L 40 /0.80 dip-
no caffeine
ping objective. 60 l of 10 mg/ml caffeine was
24.6
******
added into the dish for a final concentration of
0.375 mg/ml following 3 min of baseline imag-
24.2
ing. In the water control, 60 l of water was
added. To quantify yellow fluorescent protein
23.8
(YFP) (525 nm)/cyan fluorescent protein
(CFP) (475 nm) peak values, spectral analysis
0.5 mg/ml
was used, taking images from 470 nm to 599
caffeine
caffeine (mg/ml)
nm in 10 nm increments at 256 256 pixels,
700 Hz, and a line average of two every 20 s.
Regions of interest (ROIs) on the brains were
selected and examined for changes in YFP/CFP
Figure 2. Effects of caffeine on circadian period. A, Average activity profiles are shown for female flies fed no caffeine or 0.5
peak height value on the spectral analysis.
mg/ml caffeine. Gray bars and black bars represent subjective day and night, respectively. B, Period (in hours) for flies fed 0 (n
Statistical analysis. For comparisons of two
62 for males, n 64 for females), 0.1 (n 61, n 63), 0.2 (n 62, n 64), or 0.5 (n 34, n 63) mg/ml caffeine. Black bars
genotypes or doses, unpaired t tests with un-
denote male flies and white bars denote female flies. **p 0.01, ***p 0.001, compared with the no-caffeine group.
equal variances were used, except for analysis
of sleep bout duration (which is not normally
distributed), where Mann Whitney U test was used. For comparisons of
more than two genotypes or doses, one-way ANOVAs with genotype or
A B
***
2.5 dose as a between-subject factor were used, and if there was a significant
+ Ado + dAdoR
1.6 *
+ Ado - dAdoR
effect, post hoc comparisons with Tukey honestly significant differences
- Ado + dAdoR
1.4
2.0
- Ado - dAdoR
(HSD) were performed. For analysis of dose-dependent caffeine re-
1.2
***
sponses in control versus dAdoR flies, two factor ANOVAs were per-
1.5
1.0
formed using genotype and caffeine doses as between-subject factors
0.8
1.0
and, if there was a significant main effect, post hoc comparisons with
0.6
Tukey HSD were performed. For analysis of FRET signals for different
0.4
0.5
regions of interest, ANOVAs were performed on data pooled in 6 min
0.2
bins, and post hoc comparisons with Tukey HSD were performed. Statis-
500 1000 1500 2000
ctrl ctrl AdoR AdoR
tical analyses were performed using STATISTICA (StatSoft).
time (sec)
H B H B
CD Results
700
12
ctrl Caffeine reduces sleep and lengthens period in Drosophila
ctrl *
dAdoR
dAdoR
600
10
As in mammals, acute caffeine administration in Drosophila
500
8 (0.25 5.0 mg/ml over 8 12 h) reduces sleep time (Hendricks et
400
6 al., 2000; Shaw et al., 2000). However, in humans, caffeine is
300
generally consumed on a chronic basis. To study the effects of
4
200
chronically feeding caffeine in Drosophila, we fed a low dose of
2
100
caffeine over a 2dperiod to wild-type (RC1) female flies. Figure
daytime nighttime daytime nighttime
1A shows a reduction in sleep mainly at night for flies fed 0.5
mg/ml caffeine in constant darkness (DD). The reduction in daily
E
sleep is dose-dependent from 0.1 to 0.5 mg/ml caffeine (Fig. 1B),
*
200
ctrl
and is significant for 0.2 and 0.5 mg/ml compared with no caf-
dAdoR
160
feine treatment. Similar results are seen over a 7 d period (sup-
plemental Fig. 1, available at www.jneurosci.org as supplemental
120
material) and also have been recently observed by Andretic et al.
80
(2008). Analysis of sleep bout architecture reveals a significant
40
increase in sleep bout number (Fig. 1C) and a significant decrease
in sleep bout duration (Fig. 1D) in a dose-dependent manner,
daytime nighttime
compared with no caffeine treatment. However, caffeine admin-
Figure 3. The Drosophila adenosine receptor (dAdoR) is not required for baseline sleep reg- istration does not appear to make female flies hyperactive as mea-
ulation. A, Ratio of phosphorylated MAP kinase (P-MAPK) to unphosphorylated MAP kinase sured by waking activity (activity/waking min) (Fig. 1E). Male
(MAPK) fromS2 cells forthe following: untransfected cellswithoutadenosine(closeddiamond,
flies exhibit a similar response to caffeine, except that they
dashed line), untransfected cells treated with 3 M adenosine (open square, dashed line),
appear to be more sensitive to its wake-promoting effects, and
dAdoR-transfected cells without adenosine (closed diamond, solid line), or dAdoR-transfected
sleep bout number is not elevated (supplemental Table 1, avail-
cellswith3 Madenosine(opensquare,solidline).Thisexperimentwasperformedthreetimes
able at www.jneurosci.org as supplemental material). We also ob-
with similar results. B, Levels of dAdoR transcript as measured by real-time PCR and normalized
served similar but less pronounced effects in a 12/12 h L/D cycle
to actin levels for control and dAdoR mutant fly heads (H) and bodies (B). *p 0.05 for control
(supplemental Fig. 2A D, available at www.jneurosci.org as supple-
headsversusbodies.***p 0.001forcontrolcomparedwithdAdoR.C,Daytimeandnighttime
mental material), and so we focused on DD behavior in subsequent
sleep in L/D for control (n 64) and dAdoR mutant (n 64) female flies. D, E, Daily sleep bout
experiments, which also allowed analysis of circadian behavior.
number (D) and daily sleep bout duration (E) for control and dAdoR female flies. For C E,
We previously showed that arousal threshold is commonly
controlsaredenotedbywhite barsanddAdoR mutants with darkbars.*p 0.05 forsleepbout
duration for dAdoR vs controls. Data from the same flies are shown for C E. ctrl, Control. reduced during sleep in short-sleeping mutants (Wu et al.,
Period (hr)
0
0
0.1
0.2
0.5
0.1
0.2
0.5
P-MAPK/MAPK
(arbitrary units)
AdoR/actin mRNA level
Sleep time (min)
Sleep bout number
Sleep bout duration (min)
11032 " J. Neurosci., September 2, 2009 " 29(35):11029 11037 Wu et al. " Caffeine and Sleep in Drosophila
2008). We therefore assayed whether
A
30 30
chronic caffeine also reduces arousal thresh-
control
deprived
old in flies. As shown in Figure 1F, flies fed
25
25
0.5 mg/ml caffeine were more likely to be
20 20
aroused from sleep using a mild or moder-
ate stimulus, compared with flies fed no
15
15
caffeine. Together, these data demon-
10
10
strate that chronic administration of caf-
feine fragments sleep and reduces arousal 5
5
threshold in Drosophila.
In addition to these effects of caffeine
ctrl
AdoR
on sleep, 0.5 mg/ml caffeine affects circa-
dian rhythms by lengthening the period
B
60
by 0.9 h for male flies and 0.5 h for
40
female flies (Fig. 2). Like its effect on sleep,
20
the effect of caffeine on circadian period is
0
dose-dependent (Fig. 2B). The lengthen-
ing of the circadian period suggests caf- -20
feine also affects central clock function. -40
ctrl
dAdoR
-60
-80
The Drosophila adenosine receptor is
-100
not required for regulation of sleep
dep reb
Caffeine has been proposed to promote
wakefulness in mammals by antagonizing Figure 4. Sleep rebound following sleep deprivation is not affected in dAdoR mutants. A, Sleep profiles plotted in 30 min bins
adenosine receptor activity, specifically for control and dAdoR female flies. White bars and black bars represent light and dark periods, respectively, and sleep deprivation
by mechanical stimulation occurred for the last 6hof the second day. B, Amount of sleep lost in minutes (dep) expressed as a
the A2A subtype (Fredholm et al., 1999;
percentage relative to sleep time for unshaken controls during the 6 h mechanical deprivation (ZT18-ZT24) and amount of sleep
Huang et al., 2005). In addition, adeno-
rebound in minutes expressed as a percentage relative to amount of sleep lost (reb) during the 6 h recovery period (ZT0-6) of the
sine has been proposed to function as a
third day is shown for control (white, n 71) and for dAdoR (black, n 72) female flies. ctrl, Control.
somnogen signaling homeostatic sleep
need (Basheer et al., 2004). Therefore, the
excision allele over a deficiency of the locus, Df(3R)Exel6214 flies
simplest model predicts that genetically eliminating adenosine
(data not shown).
signaling would result in reduced sleep or reduced sleep re-
To control for genetic background, we outcrossed dAdoR mu-
bound. In mammals, there are four adenosine receptor subtypes.
tants 5 into a wild-type background (RC1) and established sib-
In contrast, there is a single adenosine receptor gene (dAdoR,
ling controls. dAdoR mutants do not show a significant change in
CG9753) identified in Drosophila, simplifying genetic analysis
baseline daytime or nighttime sleep (Fig. 3C) in L/D, compared
(Dolezelova et al., 2007). dAdoR is most closely related to the
with background controls. Baseline sleep amount is similarly un-
mammalian A2A receptor, with which it shares 52% similarity
affected in transheterozygous dAdoR/Df(3R)Exel6214 female flies
(35% identity) over the N-terminal region. Query of the Dro-
(supplemental Fig. 3A, available at www.jneurosci.org as supple-
sophila protein database using the human A2A receptor or A1 mental material).
receptor identifies dAdoR as the single best homolog (E values
Inspection of sleep bout architecture suggests the possibility of
10 41 for A2A, and 10 24 for A1) with a variety of significantly
mild sleep fragmentation. dAdoR mutant flies display a signifi-
less similar aminergic receptors (supplemental Tables 2, 3, available
cantly increased number of nighttime sleep bouts and a signifi-
at www.jneurosci.org as supplemental material). In addition, most
cant reduction in nighttime sleep bout duration, compared with
of the amino acids relevant for adenosine binding are conserved in
controls (Fig. 3D,E). Transheterozygous dAdoR/Df(3R)Exel6214
dAdoR. Unlike other adenosine receptors, however, dAdoR also has a
females also exhibit reduced nighttime sleep bout duration com-
long ( 300 aa) cytoplasmic tail which is not conserved through
pared with controls, but this is statistically insignificant (supple-
evolution (Dolezelova et al., 2007).
mental Fig. 3C, available at www.jneurosci.org as supplemental
To confirm that dAdoR responds to adenosine, we expressed
material). Waking activity (activity/waking minute) is not con-
dAdoR in Drosophila S2 cells and found that treatment with 3 M
sistently altered in dAdoR mutants compared with controls (sup-
adenosine results in MAPK phosphorylation (Fig. 3A). Similar
plemental Fig. 3D, available at www.jneurosci.org as supplemental
results were obtained by Dolezelova et al. (2007). To test the role
material). Together, these data show that deletion of dAdoR has
of dAdoR in sleep, we generated a dAdoR deletion mutant by
no effect on baseline sleep amount, and subtle, if any, effects on
imprecise excision of KG03964, a P-element located 400 bp
sleep architecture.
downstream of dAdoR. Sequencing confirmed removal of the
To assess whether dAdoR mutants have impaired homeostatic
entire dAdoR ORF, without any effect on adjacent genes. As
regulation of sleep, we examined sleep rebound following mechan-
shown by quantitative PCR analysis in Figure 3B, dAdoR tran- ical sleep deprivation (Huber et al., 2004). As shown in Figure 4, A
script appears to be enriched in heads versus bodies in control
and B, dAdoR mutants have similar amounts of sleep rebound com-
flies and is undetectable in the dAdoR mutant. This finding is
pared with controls. Similar results were obtained for dAdoR/
consistent with previous results (Dolezelova et al., 2007) and also Df(3R)Exel6214 flies compared with control/Df(3R)Exel6214 flies
the Adult Gene Expression database (Chintapalli et al., 2007). (supplemental Fig. 4A, available at www.jneurosci.org as supple-
The dAdoR transcript was also undetectable in flies carrying the mental material). We next examined whether dAdoR mutants dis-
Sleep (per 30 min bin)
Sleep gained/lost (%)
Wu et al. " Caffeine and Sleep in Drosophila J. Neurosci., September 2, 2009 " 29(35):11029 11037 " 11033
The effects of caffeine on sleep and
AB
30
circadian rhythms are not mediated by
no caff
0.5 mg/ml
700
caff ctrl
the adenosine receptor
20
dAdoR
600
It has been proposed that, in mammals, caf-
**
***
500 ***
feine promotes wakefulness by antagoniz-
10
***
400
ing adenosine receptors, and A2A receptors
ctrl
***
30 300 in particular (Fredholm et al., 1999;
Huang et al., 2005). To test the hypothesis
200
20
that caffeine functions through antago-
100
nism of dAdoR in Drosophila, caffeine was
10
chronically administered to dAdoR female
dAdoR
flies. To our surprise, the effects of caf-
caffeine (mg/ml)
feine on sleep amount, sleep bout num-
ber, and sleep bout duration in dAdoR
CD
mutant flies were similar to its effects on
25
80
ctrl ctrl
dAdoR dAdoR controls (Fig. 5A D). Because we previ-
70
20
ously observed an increase in circadian
60
period with chronic caffeine treatment in
50
15
wild-type flies as mentioned above, we
40
10
also examined circadian period in dAdoR
30
***
***
20 mutants following caffeine treatment.
5
10 The circadian period of dAdoR mutants
was lengthened to a degree similar to
controls (Fig. 5E). Similar results were
caffeine (mg/ml)
caffeine (mg/ml)
obtained for transheterozygous dAdoR/
Df(3R)Exel6214 flies, compared with
control/Df(3R)Exel6214 flies (supple-
E
mental Fig. 5 A, B, available at www.
24.9
ctrl
*** jneurosci.org as supplemental material).
dAdoR
***
24.7 These results suggest that the effects of
caffeine on sleep and circadian rhythms
24.5
**
are not mediated through the Drosophila
adenosine receptor.
24.3
24.1
Caffeine causes widespread increase in
cAMP levels, and inhibition of the PKA
pathway blocks the effects of caffeine
on sleep
caffeine (mg/ml)
If caffeine does not act on sleep by antag-
onizing dAdoR signaling, how else might
Figure 5. TheeffectsofcaffeineonsleepandcircadianrhythmsdonotrequiredAdoR.A,Sleepprofileplottedin30minbinsforsibling it act? Caffeine, like other methylated xan-
control or dAdoR female flies fed no caffeine (open diamonds) or 0.5 mg/ml caffeine (closed squares). Gray bars and black bars represent
thines, inhibits cAMP PDE in mammalian
subjectivedayandnight,respectively.B,DailysleeptimeforsiblingcontrolordAdoRfemalefliesfed0,0.1,0.2,or0.5mg/mlcaffeine.For
cells, and indeed cAMP/PKA signaling is
controlfliesn 28(nocaffeine),n 32(0.1mg/ml),n 28(0.2mg/ml),andn 32(0.5mg/ml).FordAdoRfliesn 32(nocaffeine),
implicated in the regulation of sleep in
n 31 (0.1 mg/ml), n 32 (0.2 mg/ml), and n 30 (0.5 mg/ml). For B E, control and dAdoR are denoted with white and dark bars,
Drosophila and mammals (Hendricks et
respectively.C E,Dailysleepboutnumber(C),dailysleepboutduration(D),andcircadianperiod(E)forsiblingcontrolordAdoRfemaleflies
al., 2001; Graves et al., 2003; Joiner et al.,
fed0,0.1,0.2,or0.5mg/mlcaffeine.Analysisbytwo-factorANOVAsrevealednointeractionbetweengenotypeandcaffeinedosefordaily
2006). Biochemical data have suggested
sleep,sleepboutnumber,sleepboutduration,orperiodlength.Therewasnomaineffectofgenotypeonsleepboutnumberorsleepbout
that the concentration of caffeine re-
duration.Althoughtherewasamarginallysignificantmaineffectofgenotypeondailysleepamount( p 0.04)andperiodlength( p
quired to inhibit PDEs is higher than
0.03), post hoc Tukey HSD tests did not reveal significant differences for these phenotypes between dAdoR versus control flies receiving
equivalentcaffeinedoses.Incontrast,asignificantmaineffectofcaffeinedoseondailysleep,sleepboutduration,andperiodwasobserved, would be physiologically relevant in
andsignificancebyposthocTukeyHSDtestsisshown.**p 0.01,***p 0.001forcaffeine-treatedfliesversusnocaffeinetreatmentfor mammals (Fredholm et al., 1999), but re-
agivengenotype.DataforthesamefliesareshownforA E.caff,Caffeine;ctrl,control.
cent data suggest that at least some of the
effects of caffeine on human immune
function may involve inhibition of cAMP
played a change in the reduction of sleep latency following sleep PDE (Horrigan et al., 2006). Thus, we sought to investigate a role
deprivation. We found that deletion of dAdoR does not affect the for the cAMP-PKA pathway in the effects of caffeine on sleep.
reduction (%) in sleep latency following sleep deprivation (50.9 We first examined the effects of IBMX, a nonspecific phos-
5.8% for control vs 49.2 5.2% for dAdoR mutants, p 0.83, and phodiesterase inhibitor, and found that IBMX reduces sleep in
see also supplemental Fig. 4B, available at www.jneurosci.org as sup- RC1 flies in a dose-dependent manner, like caffeine (Fig. 6A).
plemental material). These data suggest that dAdoR is not required Also similar to caffeine, IBMX lengthens circadian period (Fig.
for homeostatic sleep regulation in Drosophila, and together with the 6B). Similar effects on sleep were obtained using other methyl-
subtle baseline sleep phenotypes seen in dAdoR mutants, suggest that xanthine derivatives (supplemental Fig. 6A,B, available at www.
dAdoR is not essential for sleep regulation. jneurosci.org as supplemental material).
Daily sleep (min)
Sleep (per 30 min bin)
0
0
0.1
0.2
0.5
0.1
0.2
0.5
Sleep bout number
Sleep bout duration (min)
0
0
0
0
0.1
0.2
0.5
0.1
0.2
0.5
0.1
0.2
0.5
0.1
0.2
0.5
Period (hr)
0
0
0.1
0.2
0.5
0.1
0.2
0.5
11034 " J. Neurosci., September 2, 2009 " 29(35):11029 11037 Wu et al. " Caffeine and Sleep in Drosophila
the possibility that caffeine activates cAMP/PKA signaling in
A
800 multiple brain regions to regulate sleep.
**
Discussion
600
***
A large body of experimental work implicates adenosine as a key
400 regulator of sleep (Basheer et al., 2004). In addition, since sleep is
thought to play a restorative role in brain energy metabolism,
200 adenosine, as a metabolic byproduct, is a particularly attractive
candidate to act as the homeostatic signal for sleep (Benington
and Heller, 1995). However, the precise mechanisms by which
0 0.025 0.05 0.1
adenosine exerts its somnogenic activity remain unclear. Much of
IBMX (mg/ml)
the evidence for a sleep-promoting role of adenosine comes from
pharmacological studies (Porkka-Heiskanen et al., 2002), but a
B
24.7
variety of physiological substrates can, like adenosine, induce
**
sleep (Ueno et al., 1983; Krueger et al., 1984, 2008; Shoham et al.,
24.6
1987; Kovalzon and Strekalova, 2006).
24.5
Genetic analyses may assist in identifying the mechanisms by
24.4
which adenosine acts to regulate sleep in vivo. To this end, mu-
24.3 tants of candidate adenosine receptors have been examined for
sleep phenotypes. However, deletion of the A1 receptor in mice
24.2
does not significantly alter baseline or homeostatic regulation of
sleep (Stenberg et al., 2003). Furthermore, A2A knock-out mice
0 0.025 0.05 0.1
IBMX (mg/ml)
have normal amounts of baseline sleep, and there are no pub-
lished data describing the homeostatic response of these mice to
sleep deprivation (Huang et al., 2005). The absence of dramatic
Figure 6. IBMX, a nonspecific PDE, mimics caffeine s effects on sleep and circadian rhythms.
effects on sleep regulation in A1 and A2A knock-out mice could be
A,Dailysleeptimeforfemalefliesfed0(n 62),0.025(n 62),0.05(n 63),or0.1(n 63)
attributed to developmental compensation or genetic redun-
mg/ml IBMX.B,Period(inhours)forfemalefliesfed0(n 28),0.025(n 29),0.05(n 28),
dancy, which ultimately could be addressed with double knock
or 0.1 (n 30) mg/ml IBMX. **p 0.01, ***p 0.001 compared with diluent alone.
outs or temporally regulated knock outs. Along these lines, Bjor-
ness et al. (2009) show that conditional knock out of the A1
If caffeine acts as a cAMP PDE, one would expect the presence adenosine receptor in mice results in attenuated SWA power at
of caffeine to elevate cAMP levels in widespread areas throughout baseline and following sleep deprivation (Bjorness et al., 2009). In
the fly brain. To assess this, we conducted in vivo FRET imaging addition, double A1/A2A knock-out mice have been described
with recently described UAS-Epac1-camps flies, which can be (Halldner et al., 2004), and it would be interesting to study the
used to overexpress Epac1-camps, a FRET-based cAMP sensor sleep phenotype in these animals.
(Nikolaev et al., 2004; Shafer et al., 2008). In this system, the Genetic analysis in fruitflies is typically less encumbered by
presence of cAMP causes a reduction in FRET from donor (CFP) problems of compensation or redundancy. For instance, se-
to recipient (YFP) chromophores. In brains where Epac1-camps quence analysis predicts only a single adenosine receptor, and we
is expressed pan-neuronally, we find that addition of caffeine and others find that this receptor responds to adenosine
leads to an increase in cAMP levels (as measured by a decrease in (Dolezelova et al., 2007). We generated a deletion mutant elimi-
YFP/CFP signal) in widespread areas throughout the brain, in- nating dAdoR and find that mutants lacking dAdoR do not exhibit
cluding areas previously implicated in sleep regulation such as clear changes in either baseline sleep or homeostatic regulation of
mushroom bodies (Joiner et al., 2006; Pitman et al., 2006) and sleep following sleep deprivation. These data are compatible
pars intercerebralis (Foltenyi et al., 2007) (Fig. 7A). with previous genetic studies of A1 and A2A knock outs in mice
To further examine whether cAMP/PKA signaling is specifi- (Stenberg et al., 2003; Huang et al., 2005). However, there are
cally required for the effects of caffeine on sleep in flies, we used several potential caveats. First, we cannot exclude the possi-
the UAS-Geneswitch system to inducibly overexpress PKAR (a bility that another unknown, and significantly less related, recep-
regulatory subunit that inhibits cAMP signaling) pan-neuronally tor responds to adenosine in Drosophila. Second, unlike changes
(Li et al., 1995; White et al., 2001). As shown in Figure 7, B and in SWA power in mammals, changes in the depth of sleep cannot
C, induction of PKAR expression pan-neuronally using elav- be strictly evaluated in our system, so we cannot rule out the
Geneswitch (elav-GS) causes an increase in sleep, as predicted possibility that the quality of sleep is altered in dAdoR flies. Along
from published wake-promoting effects of cAMP/PKA signaling these lines, there is a hint that sleep maintenance may be slightly
(Joiner et al., 2006). If PKAR is uninduced, treatment with 0.5 disturbed in dAdoR mutants. Third, there remains the possibility
mg/ml caffeine results in a significant reduction in sleep. How- that loss of dAdoR can be developmentally compensated. The last
ever, simultaneous induction of PKAR with caffeine treatment two points are underscored by the recent observation that condi-
completely suppresses the effects of caffeine on sleep (Fig. 7B,C). tional knock out of the A1 adenosine receptor in mice results in
This effect is specific, because it is not observed when the elav-GS attenuated SWA power at baseline and following sleep depriva-
driver alone is used or if the Mushroom body-Geneswitch driver is tion (Bjorness et al., 2009). Together with the large body of ex-
crossed to UAS-PKAR (Fig. 7C). Together, these data suggest that perimental work implicating adenosine in sleep regulation, these
PKA activity is required for the effects of caffeine on sleep. Given data suggest that, although adenosine almost certainly can mod-
that pan-neuronal expression of PKAR blocks the effects of ulate sleep (and slow wave sleep in particular), signaling through
caffeine on sleep and that caffeine elevates cAMP levels in adenosine receptors is not absolutely essential for regulation of
widespread areas throughout the fly brain, these data suggest sleep amount or need.
Sleep time (min)
Period (hr)
Edited by Foxit Reader
Copyright(C) by Foxit Software Company,2005-2006
Wu et al. " Caffeine and Sleep in Drosophila J. Neurosci., September 2, 2009 " 29(35):11029 11037 " 11035
For Evaluation Only.
particularly important for control of mo-
A
tor activity. Furthermore, additional re-
1.2
Caffeine
sults suggest that in mice, A2A, but not A1
Mushroom body
1.1
receptors, are required for the acute wake-
Subesophageal ganglion
1.0
Antennal lobe promoting effects of caffeine (Huang et
0.9
Pars intercerebralis
al., 2005).
Deutocerebrum
0.8
We show here that chronic adminis-
Lateral protocerebrum
tration of caffeine reduces and fragments
0.7
Central complex
sleep in Drosophila. Caffeine also appears
0.6
Water
to impact the central clock, since we find
0.5
caffeine administration lengthens circa-
0 3 6 9 12 15 18 21 24 27
dian period, a finding which has also been
Time (min)
observed in Neurospora (Feldman, 1975).
However, we were surprised to find that
B
30 30
chronic caffeine treatment had similar ef-
no caff no caff
0.5 mg/ml 0.5 mg/ml
fects on sleep and circadian rhythms in
caff caff
25 25
dAdoR mutants and controls. How do we
20 20
reconcile the discrepancy between our
findings and the A2A knock-out data? One
15 15
possibility is that acute versus chronic
10 10
exposure to caffeine involves different
5 5
mechanisms (Jacobson et al., 1996). For
instance, many of the studies describing
the blockade of locomotor stimulation in
elavGS>PKAR elavGS>PKAR
A2A knock-out mice in response to caf-
- RU486 + RU486
feine use a single bolus of caffeine (Ledent
C et al., 1997; El Yacoubi et al., 2000; Halldner
ns
1000
et al., 2004; Huang et al., 2005), whereas in
***
***
this study we feed flies caffeine chroni-
800
cally. Another possibility is that funda-
mentally different signaling mechanisms
600
regarding adenosine and caffeine are used
***
**
***
400
in mammals versus flies. Although the
***
***
latter explanation cannot be ruled out,
200
the conservation of multiple signaling
pathways underlying sleep between flies
caff - + - + - + - + - + - +
and other model systems argues against
- - + + - - + + - - + +
RU486
this possibility (Wisor et al., 2001;
elavGS> MBGS>
elavGS>
PKAR PKAR Ursin, 2002; Siegel, 2004; Kume et al.,
+
2005; Yuan et al., 2006; Allada and Siegel,
Figure 7. cAMP/PKA signaling is required for the effects of caffeine on sleep. A, Caffeine reduces Epac1-camps FRET. Average 2008; Crocker and Sehgal, 2008; Zimmer-
FRET plots, as measured by YFP/CFP peak signals, for different regions of interest (ROI) following bath application of 0.375 mg/ml
man et al., 2008).
caffeine on elav-Gal4/ ; UAS-Epac1-camps/ brains. Decreasing YFP/CFP reflects increasing cAMP levels. Arrow represents the
In addition to antagonizing adenosine
start of caffeine exposure. For each ROI, the following number of brains were analyzed as follows: mushroom body (n 7),
signaling, is there another potential mech-
subesophageal ganglion (n 8), antennal lobe (n 6), pars intercerebralis (n 3), deutocerebrum (n 6), lateral protocere-
anism of action for caffeine? Similar to the
brum (n 4), central complex (n 2). The brain ROIs in the five water-treated brains were pooled. YFP/CFP peak signals pooled
effects of caffeine, we observe a significant
in6minbinswerestatisticallydifferentfromwater(atleastp 0.05)inallregionsandallbins,exceptcentralcomplex,whichwas
reduction in sleep and increase in circa-
statistically different only for minutes 21 27, and subesophageal ganglion, which was statistically similar for minutes 15 21. B,
dian period length when we feed IBMX, a
Sleepprofilein30minbinsisshownforuninduced(leftpanel)orinduced(rightpanel)elav-GS UAS-PKARfemalefliesthatwere
nonspecific phosphodiesterase inhibitor,
fed no caffeine (open diamonds) or 0.5 mg/ml caffeine (closed squares) as indicated. Dark bars and gray bars indicate subjective
to flies. Furthermore, using FRET imag-
nighttime and daytime, respectively. C, Daily sleep time for elav-GS UAS-PKAR (n 45 47), elav-GS control background
ing of fly brains, we find that addition of
(n 15 16), or MB-GS UAS-PKAR (n 17 18) female flies. Flies were treated with 0.5 mg/ml caffeine and/or 0.5 mM RU486
caffeine results in elevation of cAMP levels
as indicated. **p 0.01, ***p 0.001 compared with - caffeine - RU486 of the same genotype. ns signifies a nonsignificant
difference. caff, Caffeine. in widespread areas in the fly brain, in-
cluding areas previously implicated in
sleep regulation. Finally, we find that
Caffeine, one of the most widely used psychostimulants, is blocking PKA signaling pan-neuronally in wild-type flies sup-
believed to promote wakefulness by antagonizing adenosine re- presses the effects of chronic caffeine on sleep. Interestingly, the
ceptor function, although at higher doses it can inhibit cAMP Drosophila D1 dopamine receptor is required for the effect of caf-
PDE (Fredholm et al., 1999). In mammals, it seems very likely feine on sleep, and this effect can be rescued by overexpression of D1
that the increase in locomotor activity induced by lower doses of in mushroom bodies (Andretic et al., 2008). Together with our data,
caffeine is mediated by the A2A receptor (Ledent et al., 1997; El it is possible that dopamine signaling in mushroom bodies acts
Yacoubi et al., 2000; Halldner et al., 2004), and indeed the A2A downstream of widespread cAMP/PKA signaling induced by
receptor is specifically enriched in the basal ganglia, a structure caffeine.
YFP/CFP peak values
Sleep (per 30 min bin)
Sleep time (min)
Edited by Foxit Reader
Copyright(C) by Foxit Software Company,2005-2006
11036 " J. Neurosci., September 2, 2009 " 29(35):11029 11037 Wu et al. " Caffeine and Sleep in Drosophila
For Evaluation Only.
the inhibitory effect of caffeine on locomotion: a study in mice lacking
We and others have shown that cAMP/PKA signaling is im-
adenosine A1 and/or A2A receptors. Neuropharmacology 46:1008 1017.
portant for promoting wakefulness in flies and mice (Hendricks
Hendricks JC, Finn SM, Panckeri KA, Chavkin J, Williams JA, Sehgal A, Pack
et al., 2001; Graves et al., 2003; Joiner et al., 2006). Given its
AI (2000) Rest in Drosophila is a sleep-like state. Neuron 25:129 138.
previously defined activity as a cAMP PDE inhibitor and the
Hendricks JC, Williams JA, Panckeri K, Kirk D, Tello M, Yin JC, Sehgal A
effect we report here on cAMP levels, we suggest that caffeine
(2001) A non-circadian role for cAMP signaling and CREB activity in
promotes wakefulness by enhancing cAMP levels. Along these
Drosophila rest homeostasis. Nat Neurosci 4:1108 1115.
lines, caffeine can inhibit cAMP PDE activity in Drosophila, and it Ho KS, Sehgal A (2005) Drosophila melanogaster: an insect model for fun-
damental studies of sleep. Methods Enzymol 393:772 793.
induces specific cytochrome genes in flies via suppression of PDE
Horrigan LA, Kelly JP, Connor TJ (2006) Immunomodulatory effects of
activity independent of dAdoR signaling (Bhaskara et al., 2008).
caffeine: friend or foe? Pharmacol Ther 111:877 892.
Furthermore, in human lymphocytes, caffeine, at physiologically
Huang ZL, Qu WM, Eguchi N, Chen JF, Schwarzschild MA, Fredholm BB,
relevant doses, appears to act through PDE to modulate im-
Urade Y, Hayaishi O (2005) Adenosine A(2A), but not A(1), receptors
mune function (Horrigan et al., 2006). Thus, we suggest that,
mediate the arousal effect of caffeine. Nat Neurosci 8:858 859.
in Drosophila, chronic effects of caffeine on sleep/wake regulation
Huang ZL, Urade Y, Hayaishi O (2007) Prostaglandins and adenosine in the
may be mediated, at least in part, by PDE inhibition. Further regulation of sleep and wakefulness. Curr Opin Pharmacol 7:33 38.
Huber R, Hill SL, Holladay C, Biesiadecki M, Tononi G, Cirelli C (2004)
genetic studies of adenosine receptor mutants and PKA signaling
Sleep homeostasis in Drosophila melanogaster. Sleep 27:628 639.
in flies and mammals will be of benefit in elucidating the precise
Jacobson KA, von Lubitz DK, Daly JW, Fredholm BB (1996) Adenosine
roles of adenosine and caffeine in sleep regulation.
receptor ligands: differences with acute versus chronic treatment. Trends
Pharmacol Sci 17:108 113.
Joiner WJ, Crocker A, White BH, Sehgal A (2006) Sleep in Drosophila is
References
regulated by adult mushroom bodies. Nature 441:757 760.
Allada R, Siegel JM (2008) Unearthing the phylogenetic roots of sleep. Curr
Kovalzon VM, Strekalova TV (2006) Delta sleep-inducing peptide (DSIP): a
Biol 18:R670 R679.
still unresolved riddle. J Neurochem 97:303 309.
Andretic R, Shaw PJ (2005) Essentials of sleep recordings in Drosophila:
Krueger JM (2008) The role of cytokines in sleep regulation. Curr Pharm
moving beyond sleep time. Methods Enzymol 393:759 772.
Des 14:3408 3416.
Andretic R, Kim YC, Jones FS, Han KA, Greenspan RJ (2008) Drosophila D1
Krueger JM, Walter J, Dinarello CA, Wolff SM, Chedid L (1984) Sleep-
dopamine receptor mediates caffeine-induced arousal. Proc Natl Acad Sci
promoting effects of endogenous pyrogen (interleukin-1). Am J Physiol
U S A 105:20392 20397.
246:R994 R999.
Basheer R, Strecker RE, Thakkar MM, McCarley RW (2004) Adenosine and
Kume K, Kume S, Park SK, Hirsh J, Jackson FR (2005) Dopamine is a reg-
sleep-wake regulation. Prog Neurobiol 73:379 396.
ulator of arousal in the fruit fly. J Neurosci 25:7377 7384.
Benington JH, Heller HC (1995) Restoration of brain energy metabolism as
Landolt HP (2008) Sleep homeostasis: a role for adenosine in humans? Bio-
the function of sleep. Prog Neurobiol 45:347 360.
chem Pharmacol 75:2070 2079.
Benington JH, Kodali SK, Heller HC (1995) Stimulation of A1 adenosine
Ledent C, Vaugeois JM, Schiffmann SN, Pedrazzini T, El Yacoubi M,
receptors mimics the electroencephalographic effects of sleep depriva-
Vanderhaeghen JJ, Costentin J, Heath JK, Vassart G, Parmentier M
tion. Brain Res 692:79 85.
(1997) Aggressiveness, hypoalgesia and high blood pressure in mice lack-
Bhaskara S, Chandrasekharan MB, Ganguly R (2008) Caffeine induction of
ing the adenosine A2a receptor. Nature 388:674 678.
Cyp6a2 and Cyp6a8 genes of Drosophila melanogaster is modulated by
Li W, Ohlmeyer JT, Lane ME, Kalderon D (1995) Function of protein kinase
cAMP and D-JUN protein levels. Gene 415:49 59.
A in hedgehog signal transduction and Drosophila imaginal disc develop-
Bjorness TE, Kelly CL, Gao T, Poffenberger V, Greene RW (2009) Control
ment. Cell 80:553 562.
and function of the homeostatic sleep response by adenosine A1 recep-
Methippara MM, Kumar S, Alam MN, Szymusiak R, McGinty D (2005)
tors. J Neurosci 29:1267 1276.
Effects on sleep of microdialysis of adenosine A1 and A2a receptor analogs
Blanco-Centurion C, Xu M, Murillo-Rodriguez E, Gerashchenko D, Shiromani
into the lateral preoptic area of rats. Am J Physiol Regul Integr Comp
AM, Salin-Pascual RJ, Hof PR, Shiromani PJ (2006) Adenosine and sleep
Physiol 289:R1715 R1723.
homeostasis in the basal forebrain. J Neurosci 26:8092 8100.
Nikolaev VO, Bünemann M, Hein L, Hannawacker A, Lohse MJ (2004)
Chintapalli VR, Wang J, Dow JA (2007) Using FlyAtlas to identify better
Novel single chain cAMP sensors for receptor-induced signal propaga-
Drosophila melanogaster models of human disease. Nat Genet 39:
tion. J Biol Chem 279:37215 37218.
715 720.
Pitman JL, McGill JJ, Keegan KP, Allada R (2006) A dynamic role for the
Crocker A, Sehgal A (2008) Octopamine regulates sleep in Drosophila
mushroom bodies in promoting sleep in Drosophila. Nature
through PKA-dependent mechanisms. J Neurosci 28:9377 9385.
441:753 756.
Dolezelova E, Nothacker HP, Civelli O, Bryant PJ, Zurovec M (2007) A
Drosophila adenosine receptor activates cAMP and calcium signaling. In- Porkka-Heiskanen T, Strecker RE, Thakkar M, Bjorkum AA, Greene RW,
McCarley RW (1997) Adenosine: a mediator of the sleep-inducing ef-
sect Biochem Mol Biol 37:318 329.
fects of prolonged wakefulness. Science 276:1265 1268.
El Yacoubi M, Ledent C, Ménard JF, Parmentier M, Costentin J, Vaugeois JM
Porkka-Heiskanen T, Alanko L, Kalinchuk A, Stenberg D (2002) Adenosine
(2000) The stimulant effects of caffeine on locomotor behaviour in mice
and sleep. Sleep Med Rev 6:321 332.
are mediated through its blockade of adenosine A(2A) receptors. Br J
Portas CM, Thakkar M, Rainnie DG, Greene RW, McCarley RW (1997)
Pharmacol 129:1465 1473.
Feldman JF (1975) Circadian periodicity a Neurospora: alteration by inhib- Role of adenosine in behavioral state modulation: a microdialysis study in
the freely moving cat. Neuroscience 79:225 235.
itors of cyclic AMP phosphodiesterase. Science 190:789 790.
Radulovacki M, Virus RM, Djuricic-Nedelson M, Green RD (1984) Aden-
Foltenyi K, Greenspan RJ, Newport JW (2007) Activation of EGFR and ERK
osine analogs and sleep in rats. J Pharmacol Exp Ther 228:268 274.
by rhomboid signaling regulates the consolidation and maintenance of
Rainnie DG, Grunze HC, McCarley RW, Greene RW (1994) Adenosine in-
sleep in Drosophila. Nat Neurosci 10:1160 1167.
Fredholm BB, Bättig K, Holmén J, Nehlig A, Zvartau EE (1999) Actions of hibition of mesopontine cholinergic neurons: implications for EEG
caffeine in the brain with special reference to factors that contribute to its arousal. Science 263:689 692.
widespread use. Pharmacol Rev 51:83 133. Shafer OT, Kim DJ, Dunbar-Yaffe R, Nikolaev VO, Lohse MJ, Taghert PH
Graves LA, Hellman K, Veasey S, Blendy JA, Pack AI, Abel T (2003) Genetic (2008) Widespread receptivity to neuropeptide PDF throughout the
evidence for a role of CREB in sustained cortical arousal. J Neurophysiol neuronal circadian clock network of Drosophila revealed by real-time
90:1152 1159. cyclic AMP imaging. Neuron 58:223 237.
Halldner L, Adén U, Dahlberg V, Johansson B, Ledent C, Fredholm BB Shaw PJ, Cirelli C, Greenspan RJ, Tononi G (2000) Correlates of sleep and
(2004) The adenosine A1 receptor contributes to the stimulatory, but not waking in Drosophila melanogaster. Science 287:1834 1837.
Wu et al. " Caffeine and Sleep in Drosophila J. Neurosci., September 2, 2009 " 29(35):11029 11037 " 11037
Shoham S, Davenne D, Cady AB, Dinarello CA, Krueger JM (1987) Recom- White B, Osterwalder T, Keshishian H (2001) Molecular genetic ap-
binant tumor necrosis factor and interleukin 1 enhance slow-wave sleep. proaches to the targeted suppression of neuronal activity. Curr Biol
Am J Physiol 253:R142 R149. 11:R1041 R1053.
Siegel JM (2004) The neurotransmitters of sleep. J Clin Psychiatry 65 [Suppl Wisor JP, Nishino S, Sora I, Uhl GH, Mignot E, Edgar DM (2001) Dopami-
16]4 7. nergic role in stimulant-induced wakefulness. J Neurosci 21:1787 1794.
Stenberg D, Litonius E, Halldner L, Johansson B, Fredholm BB, Porkka- Wu MN, Koh K, Yue Z, Joiner WJ, Sehgal A (2008) A genetic screen for sleep
Heiskanen T (2003) Sleep and its homeostatic regulation in mice lacking and circadian mutants reveals mechanisms underlying regulation of sleep
the adenosine A1 receptor. J Sleep Res 12:283 290. in Drosophila. Sleep 31:465 472.
Thakkar MM, Winston S, McCarley RW (2003) A1 receptor and ad- Yuan Q, Joiner WJ, Sehgal A (2006) A sleep-promoting role for the
enosinergic homeostatic regulation of sleep-wakefulness: effects of Drosophila serotonin receptor 1A. Curr Biol 16:1051 1062.
antisense to the A1 receptor in the cholinergic basal forebrain. J Neu- Zheng X, Yang Z, Yue Z, Alvarez JD, Sehgal A (2007) FOXO and insulin
rosci 23:4278 4287. signaling regulate sensitivity of the circadian clock to oxidative stress.
Ueno R, Honda K, Inoué S, Hayaishi O (1983) Prostaglandin D2, a ce- Proc Natl Acad Sci U S A 104:15899 15904.
rebral sleep-inducing substance in rats. Proc Natl Acad Sci U S A Zimmerman JE, Naidoo N, Raizen DM, Pack AI (2008) Conservation of
80:1735 1737. sleep: insights from non-mammalian model systems. Trends Neurosci
Ursin R (2002) Serotonin and sleep. Sleep Med Rev 6:55 69. 31:371 376.
Wyszukiwarka
Podobne podstrony:
The effects of context on incidental vocabulary learning22 THE EFFECTS OF RADIATION ON THE HUMAN BODYTHE EFFECT OF WELFARE ON WORK AND MARRIAGEThe Effects of Vias on PCB TracesCurseu, Schruijer The Effects of Framing on Inter group NegotiationEffect of caffeine on short hole borer beetleeffect of varying doses of caffeine on life span D melanogasterResearch into the Effect of Loosening in Failed RockAndo An Evaluation Of The Effects Of Scattered Reflections In A Sound FieldRiordan J The Impact of Communism on SportRadiative Ignition of Pyrotechnics Effect of Wavelength on Ignition Thresholdthe estimation of?fort?sed on use?ses?41D15BThe research of VPN on WLANThe effects of extracellular polymeric substances19 Effect of temperature on tensile properties of HDPE pipe materialTHE IMPACT OF REFERENDUMS ON THE PROCESS OF EUROPEAN INTEGRATIONwięcej podobnych podstron